Algorithm analysis designpekerjaan

Tapis

Carian terbaru saya
Tapis melalui:
Bajet
hingga
hingga
hingga
Jenis
Kemahiran
Bahasa
    Status Pekerjaan
    150,570 algorithm analysis design tugasan ditemui, harga dalam USD

    project ini merupakan fyp saya. saya perlu mencari error dalam sliding mode contoller dan PID controller dalam pre-sliding motion. sya perlukan sesorang yang boleh buat PID dan SMC simulink dan saya hanya perlu masukan nila transfer function nilai x untuk cari error. nilai transfer function sudah diberi.

    $25 (Avg Bid)
    $25 Avg Bida
    3 bida
    $21 Avg Bida
    3 bida

    Analisa tulisan tangan untuk keperluan rekrutmen

    $159 (Avg Bid)
    $159 Avg Bida
    1 bida

    speed data entry, data processing and audit report, financial report and taxation Melakukan data entry laporan harian dan bulanan, cash and bank report, export and import, inventory control report, data analysis and as a translator english to indonesia,

    $277 (Avg Bid)
    $277 Avg Bida
    1 bida

    GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM

    $502 - $1004
    $502 - $1004
    0 bida

    Milestone1: Upto 2-3 Pages It should contain the following. 1. Project charter 2. Problem statement – Existing problem or Goal statement – New / Idea 3. Business case Why is this project worth doing now? What are the consequences of not doing this project? Declare processes on the basis of priority (high , medium & low). It shoul...

    $75 (Avg Bid)
    $75 Avg Bida
    4 bida

    Hi, I’m looking for an expert in statistics and especially operations research, he or she need to be available immediately to help solve problems in operations research related to the following topics and concepts: - Linear programming - Sensitivity analysis - Graphical method - Simplex method - Shadow price - Dual problems - Binding & non-binding constraints Must be expert in the menti...

    $50 (Avg Bid)
    $50 Avg Bida
    4 bida

    We are a newly launched startup, based out of Bangalore in India. We are creating a premium silver jewelry D2C brand and our website has just been launched. Seeking a digital marketeer with experience in jewelry e-commerce or at the least in the lifestyle space to help us with our digital marketing. We are looking for support in paid marketing through social media marketing and Google SEM. This ...

    $301 (Avg Bid)
    $301 Avg Bida
    7 bida

    It’s a civil engineering work, and require a SAP expert ,with extensive training in structures and concrete and long experience in structural analysis. Require some structural , model, drawings and comprobations.

    $72 (Avg Bid)
    $72 Avg Bida
    4 bida

    In a paragraph: -------------- There are a lot of software robots trying to access the servers in the Internet without permission. It is neccesary to make an application running continuously in the server to be a guard of what is happening related to attacks, work-load and unauthorized access to the server. Server characteristics: --------- Hardware: CPU: Intel(R) Xeon(R) CPU E3-1270 v6 @ 3.80GHz...

    $36 (Avg Bid)
    $36 Avg Bida
    1 bida

    Statistical analysis is needed to be done for a secondary database, which needs descriptive statistical analysis to see the relationship between dependent and independent variables, also Chi-square tests and Logistic regression analysis. For a cross-sectional study in malnutrition.

    $111 (Avg Bid)
    $111 Avg Bida
    21 bida
    Finance project 6 hari left
    DISAHKAN

    I want someone expert in finance to do a financial analysis of 4 companies , the data will be provided to you , all you have to do is analyze the data and present the findings , this is small task of max budget $10

    $15 (Avg Bid)
    $15 Avg Bida
    10 bida
    Article analysis 6 hari left
    DISAHKAN

    Article analysis following certain criteria.

    $21 (Avg Bid)
    $21 Avg Bida
    27 bida

    Will provide you the MT data and you have to predict the variables using PSO algorithm

    $8 - $20
    $8 - $20
    0 bida

    What is required? - Writing bibliometric article (similar to the model paper) with the same structure - Key words: o Digitization; Internationalization; Science Mapping; Bibliometric Analysis; Content Analysis; International Business - Introduction Research Question: What are the research perspectives dealing with digitization and internationalization? In order to answer the research question: ...

    $101 (Avg Bid)
    $101 Avg Bida
    20 bida

    The Master’s thesis is “Social Media and Society” and its title is: The impact of digital opinion leadership on political interest and participation in post-dictatorship Tunisia. I will provide the part of the thesis which is made up of the introduction and the literature review for better understanding of the research questions and the scope of the explored possible results. I w...

    $212 (Avg Bid)
    $212 Avg Bida
    13 bida
    sistema ERP 6 hari left

    Hi, At this moment we have a system developed in Java with spring, hibernate and jpa with a database in MySQL, which allows us to add, modify products with simple data such as code, barcode, purchase price,% of profit, per family o type of product and supplier and a simple inventory. Customers and suppliers with simple data such as address and personal data, accounts receivable with receipts, use...

    $4750 (Avg Bid)
    $4750 Avg Bida
    4 bida

    I need a BA to research all the AI Categories and Sub Categories for a Artificial Intelligence website. Also help with website copy.

    $99 (Avg Bid)
    $99 Avg Bida
    20 bida
    VLSI Design Automation 6 hari left
    DISAHKAN

    I have an assignment in VLSI design automation. It's about implementing Kernighan-Lin (KL) algorithm by using C++ in Visual Studio. I have the code already. All what we need to do is adding some extra lines of code to make the project complete. Also, I have notes about these lines of code. Can anyone help me to do this assignment? Thank you so much.

    $25 (Avg Bid)
    $25 Avg Bida
    2 bida

    Dc-Dc converters are massively used for switch mode regulated power supply, renewable energy conversion system and electrical drives. In this paper we have implemented digital PID controller voltage mode control method on the dc-dc buck converter. Digital controller application is considered due to their superiority than the analog converter and due to more reliability. These converters are nonlin...

    $8 (Avg Bid)
    $8 Avg Bida
    1 bida

    Use the data to conduct profitability comparative analysis Use software modeling to do linear regression analysis. Need methodology and result discussion

    $126 (Avg Bid)
    $126 Avg Bida
    13 bida

    I have one medical use case which requires a mobile app and a neural engine that will consume the 2D image and convert it into a 3D model So basically, we need an app that can take pictures from all angles then convert them into the 3D model using an algorithm.

    $367 (Avg Bid)
    $367 Avg Bida
    2 bida

    I would like to build a deep learning model using NLP that is able to recognize hidden costs in a 10-K or 10-Q financial statement, and extract the monetary value. There are about 7 different expense categories, each category has different keywords. Here are some examples: --- "Exploratory dry-hole costs were $12.7 million, $1.3 million, and $1.0 million for the years ended December 31, 2...

    $767 (Avg Bid)
    $767 Avg Bida
    8 bida

    create decision tree ID3 algorithm and run it on three different datasets. the deadline is 12/04/2021

    $60 (Avg Bid)
    $60 Avg Bida
    1 bida

    Looking for an Analyst to analyse a dataset and answer two questions, one in SQL and the other in Python and provide results in a precise and clear presentation. This is a one time project and would need a smart analyst to handle the project.

    $27 (Avg Bid)
    $27 Avg Bida
    5 bida
    ai algorithm 6 hari left

    I have code for the genetic algorithm to choose the best meal based calories and vegetarian or not ( the code, not print fitness function and graphic )

    $21 (Avg Bid)
    $21 Avg Bida
    4 bida

    Logistic regression report, including: - Introduction - Exploratory analysis - From initial to final model - Results - Comments about the data/analysis - Interpretation and conclusions for a lay audience

    $192 (Avg Bid)
    $192 Avg Bida
    26 bida

    The job is to implement a memory management library. Library need to implement necessary initialization, allocation, deallocation. Library need to keep track of allocated and free spaces in the memory segment. Buddy memory allocation algorithm will be used. There will be functions for the library. There will be report which includes results etc. about code after writing the code. The functions and...

    $71 (Avg Bid)
    $71 Avg Bida
    5 bida

    GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM

    $20 - $167
    $20 - $167
    0 bida

    GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM

    $20 - $167
    $20 - $167
    0 bida

    I have a data analysis task.i am very honest

    $3 / hr (Avg Bid)
    $3 / hr Avg Bida
    7 bida
    Static Analysis 6 hari left

    Hi everyone, I need your help to create static analysis in Ansys Workbench. The motorcycle design was already meshed. The tasks will be, For the first time you can try to take displacements on the front wheel for x, y, z. and on the rear wheel y, and z. also set to zero displacements all revolute and translation joints . you will add gravity. And run the simulation

    $20 (Avg Bid)
    $20 Avg Bida
    7 bida

    I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG

    $6 / hr (Avg Bid)
    $6 / hr Avg Bida
    3 bida
    data processing 6 hari left

    I have a data analysis task. I needed someone who can help me with this

    $2317 (Avg Bid)
    $2317 Avg Bida
    12 bida

    The design of street lights using solar energy.

    $170 (Avg Bid)
    $170 Avg Bida
    11 bida

    This position is responsible for coding, configuration, testing, system performance optimization, and interoperability issues. The Software Developer will work with business product owners, developers, and quality analysts to drive value delivery and will participate in all phases of Agile software development. As a Senior .NET Development Consultant, you will work closely with our clients and tec...

    $16 / hr (Avg Bid)
    $16 / hr Avg Bida
    10 bida

    I show you a classification problem where you have a dataframe with 24 features and a target column with 5 categories (0,1,2,3,4) The challenge is: To Do all data analysis at your free election to understand what features could be the best to include in our model to get the higher evaluation metric Select those features that best will perform in our model At your free election do any feature eng...

    $121 (Avg Bid)
    $121 Avg Bida
    6 bida

    Use the data of attached file entitled 'Air quality data', use suitable machine learning algorithm (s) develop a ANN model to analyze the 'Sulfur dioxide' level in Jeddah. The other parameters are of input air quality parameters.  Use these data  for your ANN model development, write an article with your team around 5-6 pages includ...

    $130 (Avg Bid)
    $130 Avg Bida
    17 bida

    Need An Adult Website Built Light and Professional Complete With HTML CSS JS and as little PHP as possible Reference : [log masuk untuk melihat URL]

    $290 (Avg Bid)
    $290 Avg Bida
    3 bida
    $14 / hr Avg Bida
    10 bida

    Use the data to conduct profitability comparative analysis Use software modeling to do linear regression analysis. Need methodology and result discussion

    $81 (Avg Bid)
    $81 Avg Bida
    6 bida

    The research gap analysis requires you to study at least fifteen (15) related and recent papers presented at relevant conferences and journals. These should be related to IoT underpinning technologies, tools and models. The objective is to help you to review and evaluate state-of-the-art in IoT [log masuk untuk melihat URL] avenues such as relevant IEEE conferences or Journals as well as Elsevier&...

    $159 (Avg Bid)
    $159 Avg Bida
    14 bida

    1. Logistic regression report, including: - Introduction - Exploratory analysis - From initial to final model - Results - Comments about the data/analysis - Interpretation and conclusions for a lay audience

    $266 (Avg Bid)
    $266 Avg Bida
    20 bida

    I have a data analysis actually need a person that will be taking care of my business on my behalf

    $30 / hr (Avg Bid)
    $30 / hr Avg Bida
    14 bida

    A SAP expert require ,with extensive training in structures and concrete and long experience in structural analysis. Require some structural summary, report, model, drawings and comprobations.

    $149 (Avg Bid)
    $149 Avg Bida
    5 bida

    Greetings My requirement I need some one who will guide me and support me in my current and future online projects Freelancer must possess great skills with good communication + analytical ability , you must provide good ideas to our projects using your skills and experience Nature of the work is : online research 1) the freelancer must have excellent internet research skill a)research on go...

    $59 (Avg Bid)
    $59 Avg Bida
    22 bida

    Implement the Harris Corner Algorithm. Use the Harris corner points around the object in an image to find the object's contour. You are free to use any strategy. You can also improvise your harris corner code for this project. Steps: 1. Finding the most prominent (salient) object in the given image. (There are many saliency detection algorithms available on the internet. You can use any wh...

    $18 (Avg Bid)
    $18 Avg Bida
    1 bida

    financial and accounting, financial modeling, CFA, CPA, CIMA, stock market analysis, fundamental and technical analysis.

    $17 (Avg Bid)
    $17 Avg Bida
    5 bida

    The project is about constructing a glove factory from start to end. Below are the required things to be mentioned: • Introduction: Description of the company, nature of business, list of past awarded projects, etc. • Project details: Description, purpose, duration, location, etc. • Project selection model: Financial model or scoring model in calculation. • Project scope manag...

    $157 (Avg Bid)
    $157 Avg Bida
    4 bida