
Carian terbaru saya
Tapis melalui:
    Status Pekerjaan
    110 gac tugasan ditemui, harga dalam USD

    Hi everyone, I looking for a talented person that will be able to do an anual report for my company, with respecting the branding book. The report is 28 pages, texte, photos, logo, example... is supplyed. Thank you in adavnce for your offers! Natacha

    $220 (Avg Bid)
    $220 Avg Bida
    32 bida

    Hi All, We are a small company (4 employees) and we only u...like) D. Take care of everything: development, submitting the website for approval in a functional test environment, testing the website and updating it per comments from GAC, final publishing of the website and sending it to search engines (Google and Bing at a minimum) RSVP, Jeff

    $650 (Avg Bid)
    Dijamin Sulit Peraduan Teratas
    40 penyertaan

    Hi all, I'm working for an english speaking company, and my english is far from perfect. I'm looking for someone that can review my deliverables in english. This project will be monthly contract, renewable. Quantity of work is fluctuating, and will be report, notes, press release, etc. All document needs to remain confidential. English native language will be appreciat...

    $100 (Avg Bid)
    $100 Avg Bida
    49 bida

    Hi all, I made a design, in small format and I would like to have it in really high size : 12*5m for print. Does someone is able to do that ? The psd file will be supply, with logo.

    $24 (Avg Bid)
    $24 Avg Bida
    68 bida

    ...between sexes, economical and leadership consequences for developing world economies, the impact of US withdrawing funds/support. resources: [login to view URL] [login to view URL] [login to view URL]

    $81 (Avg Bid)
    $81 Avg Bida
    43 bida
    Trophy icon Slide Design for website Ended

    I need few banners slide for my new website that will be selling western products. Please see the below for detail on the content of banner and the sizes. Sl...background use pictures from below . My budget is $45. Please bid only if you can complete job in my budget. If you need more pictures use eBay store [login to view URL]

    $45 (Avg Bid)
    19 penyertaan

    ...your application to a version of the framework for which you have the SDK or Targeting Pack installed. Note that assemblies will be resolved from the Global Assembly Cache (GAC) and will be used in place of reference assemblies. Therefore your assembly may not be correctly targeted for the framework you intend. src (srcsrc) C:Program Files (x86)Microsoft

    $170 (Avg Bid)
    $170 Avg Bida
    8 bida

    ...currently working under GAC Shipping LTD as a Finance Executive since 2 years. In addition I have audit experiance of 2 years. Since I'm working as a Executive, I have a pretty good experiance on MS Excel, MS Word and other office packages. Also I have work experiance of ERP systems. 1. [login to view URL] 2. Movex (M3) 3. GAC [login to view URL] 4. GAC [login to view...

    $25 (Avg Bid)
    $25 Avg Bida
    1 bida

    ...msi. My client should be able to view reports from visual studio without installing any software. Any assembly must be referenced from the bin of the project, not the GAC. I will give a database for development and give the field mapping (database to report) Also Report layout (no more 5-10 fields) The web page containing the report does

    $100 (Avg Bid)
    $100 Avg Bida
    20 bida

    I need someo...my vb.net program so it will run on another computer. It gives me this error now... The application requires that assembly XXXX be installed in the Global Assembly Cache (GAC) first. The application runs on my computer just fine, but I can't install it on another computer without getting the error above. I need this ASAP.

    $27 (Avg Bid)
    $27 Avg Bida
    6 bida

    ... [login to view URL] with inventory [login to view URL] use of stemina and health/mana..everything but the movement form inventory pack. [login to view URL] Attacks,from scratch or I have A pack Called Gac from asset store. i have somewhat battle tested it but not fully yet. this could be a perfect fit. [login to view URL] jumping. [login to view URL] ground and air. [login to view...

    $956 (Avg Bid)
    $956 Avg Bida
    12 bida

    i want one good Logo for construction company , Company name : GAC CONTRACTORS CORP this name should be come on the logo , NOTE : FINAL BID $10

    $25 (Avg Bid)
    $25 Avg Bida
    68 bida

    I need a logo designed. I want one logo conpany name is , this is construction company GAC Contractors Corp

    $30 (Avg Bid)
    $30 Avg Bida
    74 bida

    create custom WSP with feature that deploys custom dll to gac. DLL will contain logic to detect the onWebPartDeleted event and do some stuff...

    $155 (Avg Bid)
    $155 Avg Bida
    11 bida

    We want to develop a website for GAC Motor Qatar ([login to view URL]) that is well optimized for the search engines and focuses on reduced bounce rates and increased site visit time. The website needs to be similar to but not exactly the same to www.gackuwait.com. The content will remain the same except localization to Qatar. We would like to know the

    $575 (Avg Bid)
    $575 Avg Bida
    63 bida

    ...looking for my website banner (size 1200x270 pix and 1000x375 pix)for this forth coming Mother Day sale. I am not a good photographer so go to my EBay store [login to view URL] for picture. Please include text " Mother Day sale and Free shipping entire store" and also include picture of purse from purse category one picture of sunglasses, and

    $10 (Avg Bid)
    3 penyertaan

    Create a SharePoint WSP that enables the Syncfusion Diagram tool to be used. WSP will have to deploy Syncfusion Java code, DLL’s into the GAC, etc. Create a default List in SharePoint that will store the Syncfusion HTML code along with the diagram's meta-data. Enable user to Add a new Diagram (i.e.: Add a new Item) using SharePoint interface, complete

    $552 (Avg Bid)
    $552 Avg Bida
    7 bida

    ...the Joint Ventures (SAIC-VW) and the Chinese companies below: BAIC BAW BYD Changan Changfeng Changhe Chery Dadi Dongfeng Everus FAW Foton Fudi Fukang Fuqi GAC Geely Gonow Great Wall Guangqi Guizhou Yunque Hafei Haima Hawtai Hongqi Huachen Brilliance Huali HuaYang JAC Jiangling Jinbei Jonway Landwind Lifan Nanjing

    $23 (Avg Bid)
    $23 Avg Bida
    17 bida

    ...And is the majority shareholder in LTI Shanghai Automobile Gonow (2003–present) Great Wall Motor (1976–present) Guangzhou Automobile Industry Group (GAIG) (2000–present) GAC Group Changfeng Motor Liebao Guangqi Honda Everus Guizhou / Yunque Hawtai (Huatai) Huachen (Brilliance) Jinbei (1992–present) Zhonghua (1985–present) Huayang Jianghuai

    $87 (Avg Bid)
    $87 Avg Bida
    12 bida

    We need to find 5 direct competing models for 7 Chinese car models (Hawtai and GAC). The competing brands have to match the model, vehicle type, engine type, dimensions and overall product quality/additions (wheels, extras). The brands that compete with Hawtai and GAC are: Hyundai, JAC, Changan, KIA, Honda, Geely, Chevrolet (basic models). Only

    $69 (Avg Bid)
    $69 Avg Bida
    11 bida

    ...according to the parameter names given in Row 1 of the "Raw Data" spreadsheet. Notes: 1. There are 8 tabs across the bottom of the "Raw Data" file (Raw, DAF, SF, Ozone, BAC, GAC, UF, Final). These correspond to the eight columns in which they must be placed in the individual spreadsheets. 2. Not all of the ~35 parameters are included in all of the 8

    $76 (Avg Bid)
    $76 Avg Bida
    1 bida

    We have a website project which is under development by one of GAC provider, and the website was using Wordpress + php and the website has completed over 90%. Here I look at a professional to fix few debugs the frontend, user panel and backend - admin panel (about 10+ bugs) of the website [login to view URL] . Also to optimize the website, and

    $2675 (Avg Bid)
    $2675 Avg Bida
    64 bida

    Hi, We have a website project which is under development by one of GAC provider, and the website was using Wordpress + php and the website has completed over 90%. Here I look at a professional to fix few debugs the frontend, user panel and backend - admin panel (about 10+ bugs) of the website topspynews com. Also to optimize the website, and thereafter

    $30 / hr (Avg Bid)
    $30 / hr Avg Bida
    35 bida

    Hi, I need to integrate shipping methods to my magento multi-store multi-domain store. I need: YUAN TONG, SHENTONG,YUNDA, ZHONGTONG, SHUNFENG for China and GAC for US. please quote price and time Thanks

    $596 (Avg Bid)
    $596 Avg Bida
    22 bida

    Hi, We have a website project which is under developement by one of GAC provider, and the website was using Wordpress + php and the website has completed over 90%. Here I look at a professional to fix few debugs the frontend, user panel and backend - admin panel (about 10+ bugs) of the website topspynews com. Also to optimize the website, and thereafter

    $486 (Avg Bid)
    $486 Avg Bida
    33 bida

    ...the OpenForexPlatform to MetaTrader. While everything compiles cleanly, on Windows 7 I get an the error message "MT4 Initialization failed. Requrired assemblies not found in GAC." (which appears to be as a result of the call to the .Net assemblies failing). It might be important to note that there is a warning on the compile about LoadLibraryShim being

    $220 (Avg Bid)
    $220 Avg Bida
    11 bida

    ...(folks who productize "granulated activated carbon" = GAC), i.e. Baker, Adler, Carbon Resources, Tigg... - building centers/hardware stores/home improvement stores (all large and small chains, such as Home Depot...) - gardening centers (all large and small chains, such as Lowe's, OSH...) - GAC end users, i.e.: waste water treatment plants, smoke stack

    $105 (Avg Bid)
    $105 Avg Bida
    2 bida

    One month of SEO for 6 keywords for GAC (URL and full name in PM).

    $156 (Avg Bid)
    $156 Avg Bida
    1 bida

    One month of SEO for 6 keywords for GAC (URL and full name in PM).

    $260 (Avg Bid)
    $260 Avg Bida
    1 bida

    For Sharepoint 2013 I want a simple example of how to create a project that deploys to the farm, there is a single visual web part that has a label and a button. Button should call a WCF service (anything public is fine) and return the results to a label. i.e. [login to view URL] = [login to view URL]("hello world"); I believe this just requires publishing the wsp and using Instal...

    $169 (Avg Bid)
    $169 Avg Bida
    4 bida

    Need a way (WCF preferable) to implement a plugin architeture in all my projects without having to copy all my plugins to output directory of all my projects, without GAC. The project itself is simple, i have my plugins located at "C:program filesMyPluginsMyplgs.dll" ... and i need to use it at my clients for all my products located in many

    $100 (Avg Bid)
    $100 Avg Bida
    1 bida

    Need a way (WCF preferable) to implement a plugin architeture in all my projects without having to copy all my plugins to output directory of all my projects, without GAC. The project itself is simple, i have my plugins located at "C:program filesMyPlugins[login to view URL]" ... and i need to use it at my clients for all my products located in many different

    $43 (Avg Bid)
    $43 Avg Bida
    3 bida

    Hey, I Need a project containing a wcf server to host my dlls, and a basic plugin architeture (using this wcf server). ...containing a wcf server to host my dlls, and a basic plugin architeture (using this wcf server). C#. More than one (different) applications will use the same dlls. Please, its not GAC, i need WCF. How much would it cost? Thanks.

    $30 (Avg Bid)
    $30 Avg Bida
    1 bida

    Hey how much would it cost for you to develope a custom project to manage dlls used by different programs? WCF, not GAC.

    $30 - $30
    $30 - $30
    0 bida

    ...completes its operation, information will displayed 2. Main page will work in AJAX mode while waiting for time jobs 3. Each time job will have a simple task to access a particular GAC assembly and return its file version. 4. Main page will handle situation if Timer Service is not running on given SharePoint Server 5. Main page will have ability to cancel

    $716 (Avg Bid)
    $716 Avg Bida
    13 bida

    We are looking for someone to scrapes sites such as http...such as [login to view URL] [login to view URL] [login to view URL] [login to view URL] [login to view URL] [login to view URL] The data will then need to be built into an application and added to our Google Map.

    $218 / hr (Avg Bid)
    $218 / hr Avg Bida
    7 bida

    ...our installer. You must provide .msi file that can check Visual Studio version availability and register assemblies in Visual Studio. Assemblies will be pre-installed into GAC before this .msi call. MSI must not create any dialogs etc. 3rd-party tools from Codeplex available to make VS2005-2008 installation simple. For VS 2010 too. You can use any

    $140 (Avg Bid)
    $140 Avg Bida
    7 bida

    ...promotional video similar to the one found at the following link: (disregard advertisement at begining) [login to view URL]

    $222 (Avg Bid)
    $222 Avg Bida
    17 bida

    I have a project I want to deploy with click once. The project uses a C++ Dll that is installed in the GAC. Currently we have a MSI installer to install the Dll, and then we deploy with Click once for the rest of the code. We want to get this to deploy the Dll with the click once all in one install. I have tried to do this by making the Dll isolated

    $255 (Avg Bid)
    $255 Avg Bida
    1 bida

    I want a multilanguage PHP web site that enables people to post lost and found objects. People register to create an ...questions. Maximum budget is 250 $. Payment will only be done by escrow and percentage of work completed according to the proposed planning. Please feel free to use the GAC chat. I may sometimes post messages to bidders there.

    $250 (Avg Bid)
    $250 Avg Bida
    9 bida

    ... PPC Registrar Aftermarket Typosquatting Semantic Technology sTLD Advisory Committee AfriNIC ALAC APNIC ARIN ASO ccNSO Domain Name Resolvers GAC GNSO IANA IETF IP (Internet Protocol) ISOC ISP LACNIC PDP (Policy Development Process) Phishing RGP RSEP RIR RIPE SSAC SO UDRP W3C

    $192 (Avg Bid)
    $192 Avg Bida
    10 bida

    Dear Providers, Welcome to my data entry project. The server is very [login to view URL] month your earn will $600usd You can run the wor...description how to get it. The target of my project is weekly 4k entry data. Per day you must complete 500-700 entries the data. Then I will pay you 7 days payment in your GAC Account. Best of luck every one.

    $3066 (Avg Bid)
    $3066 Avg Bida
    186 bida

    taka= 1908 + 2480 = Dear Providers, Welcome to my data entry project. The server is very [login to view URL] month your earn will $500us...description how to get it. The target of my project is weekly 4k entry data. Per day you must complete 500-700 entries the data. Then I will pay you 7 days payment in your GAC Account. Best of luck every one.

    $1500 - $3000
    $1500 - $3000
    0 bida

    ...distributables (So that they do not need to be runned manually separatelly) and if possible to wrap them on the setup for internet-less installations. - Might need 3-4 GAC and DLL Registry registrations. (To hide some DLLs from end users) This Project is required to be done with remote access. This needs to be done on just one session

    $20 - $25
    $20 - $25
    0 bida

    ...the order of the words. The idea would be to host said application incorporated into a web page without the need to be run locally from downloaded software. GTA//CAG//ATA//GAC//AGA// TACAGATACGATCAGTACGCATGCTGCAA etc. An example sequence can be seen above. This would be pasted into the box and then each 3 letter word (separated with ‘//’ for

    $30 - $250
    $30 - $250
    5 bida

    I need a simple console application that will check, at the press of a button, to see if a specific IHttpModule (one that is already in the GAC) is registered with a SharePoint 2010 site (assume localhost on port 80) and, if it's not, register it. If needed, I can provide a simple 'Hello World'-type iHttpModule object for testing. This should be written

    $167 (Avg Bid)
    $167 Avg Bida
    10 bida

    Dear Providers, Welcome to my data entry project. The...description how to get it. The target of my project is 7000k to 10000k entry data. Per day you must complete 1000k entry the data. Then I will pay you 7 days payment in your GAC Account. Per 1000k data entry you will have 70cent. Best of luck every one. Thanks Ricky [Removed by Admin]

    $289 (Avg Bid)
    $289 Avg Bida
    35 bida

    Dear Providers, Welcome to my data entry project. The...description how to get it. The target of my project is 7000k to 10000k entry data. Per day you must complete 1000k entry the data. Then I will pay you 7 days payment in your GAC Account. Per 1000k data entry you will have 70cent. Best of luck every one. Thanks Ricky [Removed by Admin]

    $321 (Avg Bid)
    $321 Avg Bida
    61 bida

    Dear Providers, Welcome to my data entry project. The...description how to get it. The target of my project is 7000k to 10000k entry data. Per day you must complete 1000k entry the data. Then I will pay you 7 days payment in your GAC Account. Per 1000k data entry you will have 70cent. Best of luck every one. Thanks Ricky [Removed by Admin]

    $304 (Avg Bid)
    $304 Avg Bida
    105 bida