Gacpekerjaan
**Need an expert to complete/finish a MSI setup package unless coder prefers to create one from scratch using InnoSetup, NSIS or any other open source solution. Right now, I...But installer has to be professional and do the following: - Make sure installation is updateable (So it doesnt require a previous installation uninstalled) - Include on it Framework 3.5, Access and Windows Installer distributables (So that they do not need to be runned manually separatelly) and if possible to wrap them on the setup for internet-less installations. - Might need 3-4 GAC and DLL Registry registrations. (To hide some DLLs from end users) This Project is required to be done with remote access. This needs to be done on just one session. So, ONLY TRULLY EXPERTS required...
...The codons could be thought of as words, so a language with 64 3-letter words with each word being linked to its own individual note, the sentence (nucleotide sequence) would then be entered and a sound file produced based on the order of the words. The idea would be to host said application incorporated into a web page without the need to be run locally from downloaded software. GTA//CAG//ATA//GAC//AGA// TACAGATACGATCAGTACGCATGCTGCAA etc. An example sequence can be seen above. This would be pasted into the box and then each 3 letter word (separated with ‘//’ for clarity) would be read and in turn trigger the corresponding note. Apart from a few key details this is somewhat flexible. I would like a text entry box into which the nucleotide sequence is to be...
I need a simple console application that will check, at the press of a button, to see if a specific IHttpModule (one that is already in the GAC) is registered with a SharePoint 2010 site (assume localhost on port 80) and, if it's not, register it. If needed, I can provide a simple 'Hello World'-type iHttpModule object for testing. This should be written in C#. We are a new startup, and this is a simple project to test the waters with outsourcing some of our development. There is a strong possibility for more work to come if we are happy with the outcome here.
Dear Providers, Welcome to my data entry project. The server is very first. You can run the work GMT+5.5 Indian time 11.00pm to 6.00am. My data entry project is very easy to work. I hope you are enjoying working it. Please follow the description how to get it. The targe...Providers, Welcome to my data entry project. The server is very first. You can run the work GMT+5.5 Indian time 11.00pm to 6.00am. My data entry project is very easy to work. I hope you are enjoying working it. Please follow the description how to get it. The target of my project is 7000k to 10000k entry data. Per day you must complete 1000k entry the data. Then I will pay you 7 days payment in your GAC Account. Per 1000k data entry you will have 70cent. Best of luck every one. Thanks Ricky [Removed...
Dear Providers, Welcome to my data entry project. The server is very first. You can run the work GMT+5.5 Indian time 11.00pm to 6.00am. My data entry project is very easy to work. I hope you are enjoying working it. Please follow the description how to get it. The targe...Providers, Welcome to my data entry project. The server is very first. You can run the work GMT+5.5 Indian time 11.00pm to 6.00am. My data entry project is very easy to work. I hope you are enjoying working it. Please follow the description how to get it. The target of my project is 7000k to 10000k entry data. Per day you must complete 1000k entry the data. Then I will pay you 7 days payment in your GAC Account. Per 1000k data entry you will have 70cent. Best of luck every one. Thanks Ricky [Removed...
Dear Providers, Welcome to my data entry project. The server is very first. You can run the work GMT+5.5 Indian time 11.00pm to 6.00am. My data entry project is very easy to work. I hope you are enjoying working it. Please follow the description how to get it. The targe...Providers, Welcome to my data entry project. The server is very first. You can run the work GMT+5.5 Indian time 11.00pm to 6.00am. My data entry project is very easy to work. I hope you are enjoying working it. Please follow the description how to get it. The target of my project is 7000k to 10000k entry data. Per day you must complete 1000k entry the data. Then I will pay you 7 days payment in your GAC Account. Per 1000k data entry you will have 70cent. Best of luck every one. Thanks Ricky [Removed...
Sila Dafter atau Log masuk untuk melihat butiran.
Dear Providers, Welcome to my data entry project. The server is very first. You can run the work GMT+5.5 Indian time 11.00pm to 6.00am. My data entry project is very easy to work. I hope you are enjoying working it. Please follow the description how to get it. The targe...Providers, Welcome to my data entry project. The server is very first. You can run the work GMT+5.5 Indian time 11.00pm to 6.00am. My data entry project is very easy to work. I hope you are enjoying working it. Please follow the description how to get it. The target of my project is 7000k to 10000k entry data. Per day you must complete 1000k entry the data. Then I will pay you 7 days payment in your GAC Account. Per 1000k data entry you will have 70cent. Best of luck every one. Thanks Ricky [Removed...
Dear Providers, Welcome to my data entry project. The server is very first. You can run the work GMT+5.5 Indian time 11.00pm to 6.00am. My data entry project is very easy to work. I hope you are enjoying working it. Please follow the description how to get...Providers, Welcome to my data entry project. The server is very first. You can run the work GMT+5.5 Indian time 11.00pm to 6.00am. My data entry project is very easy to work. I hope you are enjoying working it. Please follow the description how to get it. The target of my project is 7000k to 10000k entry data. Per day you must complete 1000k entry the data. Then I will pay you 7 days payment in your GAC Account. Per 1000k data entry you will have 70cent. Best of luck every one. Thanks
Dear Providers, Welcome to my data entry project. The server is very first. You can run the work GMT+5.5 Indian time 11.00pm to 6.00am. My data entry project is very easy to work. I hope you are enjoying working it. Please follow the description how to get it. The targe...Providers, Welcome to my data entry project. The server is very first. You can run the work GMT+5.5 Indian time 11.00pm to 6.00am. My data entry project is very easy to work. I hope you are enjoying working it. Please follow the description how to get it. The target of my project is 7000k to 10000k entry data. Per day you must complete 1000k entry the data. Then I will pay you 7 days payment in your GAC Account. Per 1000k data entry you will have 70cent. Best of luck every one. Thanks Ricky [Removed...
My site, is down after I moved from one host to another. We can't get the server to point to the home the old server, where the is located is nested inside another folder. public_html / html / So, we need to get to that folder/file. My webmaster doesn't know how to change that setting. Please check the site...point to the home the old server, where the is located is nested inside another folder. public_html / html / So, we need to get to that folder/file. My webmaster doesn't know how to change that setting. Please check the site files (5gb total) to find an correct the index file so that the site is LIVE! Confusing to me, but probably a simple matter for a great GAC to get my site up and running.
Hi, I need to use a COM object from the following address on our website. The guys over there told me that there are people using it like that but they don't know much about web servers. I need someone to help me through this. I tried putting it into the GAC and it said that it's missing the manifest. We are using ASP VB.NET on a Windows Server 2008 (WebServer Edition) IIS 7 Thanks, Ed ## Deliverables 1) Complete and fully-functional working program(s) in executable form as well as complete source code of all work done. 2) Deliverables must be in ready-to-run condition, as follows (depending on the nature of the deliverables): a) For web sites or other server-side deliverables intended to only ever exist in one place in the Buyer's envir
Hi, I need to use a COM object from the following address on our website. The guys over there told me that there are people using it like that but they don't know much about web servers. I need someone to help me through this. I tried putting it into the GAC and it said that it's missing the manifest. We are using ASP VB.NET on a Windows Server 2008 (WebServer Edition) IIS 7 Thanks, Ed ## Deliverables 1) Complete and fully-functional working program(s) in executable form as well as complete source code of all work done. 2) Deliverables must be in ready-to-run condition, as follows (depending on the nature of the deliverables): a) For web sites or other server-side deliverables intended to only ever exist in one place in the Buyer's envir
...When saved a new version is saved and the previous version is still available. N number of versions is to be saved in the XML-file. 6. Each document has its own XML-file containing all saved versions. Version Control The most important part is the version control. I see three possibilities; 1. Use existing free version control components. However, it is not possible to register any COM-objects or GAC any dll. 2. Come up with your own solution using delta changes. 3. Save complete text in every version. Interface There should be an interface for the following: • Create/Edit a binder • Binder overview with the following o Binder information o Documents in the binder. Drag and drop functionality to change sort order • Create/Edit a document in selected binder. A new d...
...assumed that it is ethical and "white hat". I expect periodical email correspondence (ie. weekly) to discuss the ongoing efforts and the strategies you are using. I don�t need artificial traffic. The only thing i am interested in is organic traffic from the search engines. So don�t use services like Traffic Exchanges, Paid2Read, Paid4Surf etc. For all payments I will use the GAC escrow service. Each link must be located on URL with PR4 or greater. Each link should be unique and must come from a different class C IP address. Other requirements on this Link Building project: The link page must be included in the main Google index (no supp index). Each link must be from a completely separate IP address. General directories will not be used. Links must...
I have an ASP.NET website (VB) which has moved to a new host. The old host was webhost4life and the new one is Heart internet (UK). Since moving the website doesn?€™t work. It looks like the new host is missing the J++ runtime from the GAC but I could be wrong. The old host is likely to have had these libraries installed at GAC level but the new one does not so it needs these compiled into the solution and redeployed. Either way, I need someone to successfully diagnose, fix and upload the new site. I do not want to spend any time doing any code or advise work on this. I will deliver to you a full Visual Studio solution (2008 I think, could be wrong) and I need you to install it locally, get it running and then deploy this to the new host. FTP details etc. Will b...
We have distributed a package to pc's that destroys the fusion cache on pc's. The application should have been packaged as a dotnet application but it has not. By distributing an application that distributes GAC registry keys hardcoded to the registry it distroys the counters of these assemblies. Any idea how we could make sure that the fusion cache is repaired to it's healthy state that it was in before the erroneous package was distributed. I would to purchase from you a script or a tool (preferably in vbscript)? that can automatically fix this problem.
We need 5 different Joomla 1.5 templates, which look-and-feels fit for a small/mid-size industrial art company. We don't mind the provider taking existing templates and eve...only is o.k., some 10-15 pieces, of which we try to choose the 5. We may also choose less or none, if we don't like the 10-15. Then the provider is to show us more possible templates. And so on, until we chose 5 templates in sum. In the second part, for those 5 templates we get the provider a list of wishes in layout changes, color changes and so on. The provider does the work. We pay through GAC-escrow only. Concerning the Provider Please present your references, and please send us an example of your HTML / CSS capatibilities (yes, some code too, please). Please mention "JoomlaTask23.1&q...
Hi, we have a SEO company. We are so bogged up with our work and our employees that we don’t get time to get bid for new projects, market for new clients and find new projects. Finding good, solid ongoing clients is very time consuming so we are looking for people, salespeople or account managers. Simply people who can put our name around, bid on projects in GAF, odesk, elance, GAC, etc. We are offering 10% of the overall sale for any successful work that comes our way from you and a monthly pay of 150$+ commission. We offer SEO services in a very competitive rate and with proven track records. Your role is to find the clients who are able to place relatively high volume orders. You will be able to choose the strategy of generating sales, subject to our approval. We will...
I would like to know how harmfull it is not to capture a dotnet application with Wise Package Studio 7 as a dotnet application. ## Deliverables The official way to handle dotnet applications is described here: <> But if you capture dotnet related files and registry keys as is, does this really have any disadvantages ? I can imagine that one can have problems with dotnet security configurations but I cannot see any other problems.
Hi We are looking for a pre-made script clone of Scriptlance or Get-A-Coder, and we will need it uploaded/installed on our server. We want it with a clean new design, Web 2.0 look & feel, and most importantly, must have all the same functionality of Scriptlance. This pre-made script clone must have all the same payment processors and also the escrow option. No bugs no glitches. I need it to supporting multi-languages. Please review the site prior to bidding so you are familiar. In addition, please post the word "README" in your bid response and with the script Demo URL for use to review, to ensure you are actually reading these specs and not just auto-posting. If the "word" is not in your bid, the bid will not be accepted You will need you to ...
I require the following skills any additional information will follow via the PMB: Sharepoint Configuration Sharepoint Object Model Advanced Workflows C# WebPart Development GAC SQL 2005/8 Database The work is quite complex and is required urgently......I would estimate about 2-3 days worth.
I require the following skills any additional information will follow via the PMB: Sharepoint Object Model Advanced Workflows C# WebPart Development GAC SQL 2005/8 Database The work is quite complex and is required urgently......I would estimate about 5-7 days worth.
...to advise on time spent & report regularly (daily) Constant contact is NOT required. Possible Bonus Skills that would be an advantage (NOT ESSENTIAL):- - Excellent design skills - Knowledge of ASP .NET - Significant competent knowledge of SEO/link buliding - Video integration, Blog experience, Google maps integration - CRM integration - Experience of subcontractiing jobs on GURU/GAF/GAC etc - copywriting Please quote based on 8 working hours...this is the length of the trial period....and it would be expected that this would be the number of hours per week with a view to this increasing. Please understand how I've asked for the quote and provide exactly as such....if these simple instructions haven't been read and understood & followed then there...
I've created a website based on websitebaker, where the design mainly is css-driven. There are some smaller mistakes still in the css I'm not able to fix: - borders and margins in nested ul list of the 2nd menu - height of different boxes don't react as they should - cross-browser problems I therefore need someone who can fix ...smaller mistakes still in the css I'm not able to fix: - borders and margins in nested ul list of the 2nd menu - height of different boxes don't react as they should - cross-browser problems I therefore need someone who can fix my css so it works correctly. The website is in german, but this shouldn't matter. P.S. - Sorry, can't post the link to the website as this would violated the GAC rules. I have ...
Well I need a solid programmer. You must be quick and efficient. I need someone that cloning website scripts and backend systems is there specialty. I need someone that I can say clone “example site” and they get to work can do the work in 1-2 days for the sites I require. I don’t need design I just need the scripts to be cloned so we can modif...that I can say clone “example site” and they get to work can do the work in 1-2 days for the sites I require. I don’t need design I just need the scripts to be cloned so we can modify to the sites we have under development. In a week you should be able to clone at least 3-4 sites. I need 10 sites cloned. I have a budget of $500 per script cloned. Pay in 2 weeks, and project complete. I will use GAC/Bank/...
hello, i am recently launching a website which is relate to directory submission & seo service. i need a person or a company who can provide me provide me with a fresh content for the website. i will check the content with copyscam so it should easily pass through it & should be seo frendly also. if you have a...relate to directory submission & seo service. i need a person or a company who can provide me provide me with a fresh content for the website. i will check the content with copyscam so it should easily pass through it & should be seo frendly also. if you have any more questions do let me know. **NO ESCROW, MILESTONE or ADVANCE WILL BE ENTERTAINED. PAYMENT WILL BE MADE VIA GAC or Paypal or Western Union upon 100% completion of th...
...once the TRUST is established, I will pay you in Advance. Yes, you heard me right in Advance. Which means I will pay you first then you do the work. BOTTOMLINE you will be paid handsomely well. Important: Primarily I am looking for Individuals. I may consider companies but for fixed price basis. PREFERENCE will be given to individuals working with established companies operating on E-lance, GAF, GAC, RAC, Script-lance, G uru, O-desk etc. IMMEDIATE REQUIREMENT: Individual Designers/coders/developers with SOCIAL NETWORK experience. Once again let me reiterate, BIDS WITHOUT CV's ATTACHED & REFERENCE URL's WILL BE DECLINED. For Companies, please provide a formal proposal in doc or pdf. If you have questions, don't hesitate to ask? I am on a deadline, so guys please...
I am a C# developer.? ? I have determine (maybe wrong) that Microsoft has a bug in their primary interop assembly (usually found in GAC).? Let me start with the way things work in C++: There is a method i need access to contained in an interface called IDisplayService and its called TransformRect.? It simply transforms a rectangle from client coordinates to screen coordinates.? Unfortunately, i have concluded that it is inaccessible from .NET because the assembly contains a definition of the interface but does not have any implementors... that right? its an orphaned interface with no implementations.? Its supposed to be implemented by HTMLDocument2Class, but its not.? ? This seems to be an oversight, but its killing me.? ? I understand
A user will enter userid and password via an html form. I need to take the input variables and authenticate them against the LDAP-Active Directory. I prefer to have this done in classic ASP. If this cannot be done in straight ASP, I will consider ADP .Net (C#), but it would have to be a .dll that will be called from ASP. If...(C#), but it would have to be a .dll that will be called from ASP. If you use ASP .Net I would need the 2 programs 1- ASP program will a call and a 2. .Net DLL that would do the authentication. Th ASP .Net would just return True or False back to the program indicating whether the authentication was successful. Also I would need step by step directions for registering the .dll (i.e. regasm, copy to GAC ...) as well as an explantion of the LDAP parameters (i.e OU...
Hi, I need clone of GAF, GAC. A live link should be there to view Front end and back end.
I am looking for a clone of website for freelancers. I do have some different ideas to implement in addition, but what I am looking for is like GAF or GAC or SL. Additional idea will be discussed with the selected service provider as it will be a different thing which will going to be a different project again. So, rightnow please dont include the additional budget in your bid. This is just a basic clone to complete rightnow. I dont have any high budget, and time period is also limited. Also, the selected buyer have to give service until I test it and find it 100% working as per the requirement. So far my payment terms is purely through SL. Please bid and give me details about your self, your availibitlity, payment terms , and time limit. My schedule is very tight so I need...
I need a Clone of I want to have all the same functions but the flexibility to change the logo and header design and such. Please only bid on this project if you have done similar projects in the past or have a working script already developed and can show a demo of all the functions that you can offer. I need this project finished asap and am ONLY looking for a competent individual/company that i can establish a long lasting working relationship with as we already have a large amount of projects that will need attention in the very near future. Do not bid if you are expecting advances in payment before the work has been done as i will only pay once the work is finished and is up to my expectations and i i won't accept any bids over $250 as that is the top of my budget rang...
I am looking for a clone of website for freelancers. I do have some different ideas to implement in addition, but what I am looking for is like GAF or GAC or SL. Additional idea will be discussed with the selected service provider as it will be a different thing which will going to be a different project again. So, rightnow please dont include the additional budget in your bid. This is just a basic clone to complete rightnow. I dont have any high budget, and time period is also limited. Also, the selected buyer have to give service until I test it and find it 100% working as per the requirement. So far my payment terms is purely through SL. Please bid and give me details about your self, your availibitlity, payment terms , and time limit. My schedule is very tight so I need...
Do you have a ready script for a freelance website? It should not be one of those readily available open source scripts available on the internet from $15 to $35 Please bid, if and only if you want to resale an original work of yours. I do not want any customized open source script as well. Please bid if you have an original one written from scratch. I will prefer PHP/MySQL but I can manage with ASP.NET / MS SQL as well Please do not bid if you are planning to or you think you can make one such. I neither have time nor funds to get one made just for me I am only looking for 1. It should be ready and you willing to just resale. 2. It should be your original work from scratch. Thanks
Hi all ??" ? I need three things.? ? 1)? ? ? ? ? A blog-type site with 50 + articles about ghost writing and self publishing articles that is highly SEO.? Like <> 2)? ? ? ? ? A project for hire site for independent writers to bid on projects posted by clients.? I know that there a...ghost writing and self publishing articles that is highly SEO.? Like <> 2)? ? ? ? ? A project for hire site for independent writers to bid on projects posted by clients.? I know that there are many free or very cheap application available, although they would need to be customized for writing projects. 3)? ? ? ? ? Recruiting effort across existing sites like RAC, GAC, elance, scriptlance, etc for writers, ghostwriters, authors, translators, etc.
Sila Dafter atau Log masuk untuk melihat butiran.
PROJECT / POSITION TITL...Press Kit (1) Media Kits (53) (#) Number of document's need for this type of document. PROJECT DURATION: All works needs to be completed in 30 – 45 from date project was awarded. PROJECT BUDGET, PAYMENT, & TERMS Payment for services of developing the following marketing materials package is $3500.00 US. Payment will be paid at provider's request through two methods Pay Pal or GAC. Payment will be paid once all work has been completed, checked, all changes and corrections have been made. Payment made promptly. I will not use escrow of milestones. Additional information: Submitted on 11/20/2007 at 18:34 EST Project Requirements Must develop the following document Marketing Plan (1) Business Plan (2) Press K...
...capabilities 12. Clone or similar to ***Note: Some of these systems will have modifications and additions to them to make then unique systems****** ***** If you can not work with every stated term including my payment terms, my working process, my contract terms, and my deadline terms, don't bid and waist each others time.**** Terms & Conditions 1. I will not use GAC escrow. I will not pay after each system is developed. I will pay only once all 15 systems have been developed, checked, and delivered. 2. My budget is $10,000 US not a penny more. Strict Budget 3. Do not state your company polices or payment terms as stated these are my working terms. 4. Provide must provide effective communication, answer emails, and open for communication. 5. Must be abl...
I a...package. this is a package with a total project budget of $4000.00 US. This is a complete project and will not be broken up into milestones or payments. Good work here could turn into long term relationship. This is a package. I don’t do escrow. I do require a contract to be signed. You must meet weekly deadlines of production. Payment is $4000.00 for the entire project. Payment paid through GAC or PayPal only. Payment paid once all contracted logo packages have been developed and delivered per contract agreement. Only serious providers please give ur portfolio i need creative designers. Please show samples of your programming work. Please provide samples of your skills and work. No samples your bid will be removed. 45 day project must produce 20 Logo packages per we...
...centers only around the ability to upload a DLL, GAC it, persist and inflate information based on an object model, and a nice interface to support it *************************************** This project will center on the ability to dynamically configure and launch WCF Services from strongly named assemblies that reside in the GAC. Key aspects of a WCF Service will be identified later in this document as pieces that will need to be configurable and stored in a database. There are 4 key components to this project which will be broken into phases of defined completion. 1) ASP.NET Interface to enable an end user to upload an assembly (dll) and register it in the GAC and database. The assembly that registers the uploaded file into the GAC must work wit...
...user usernode userpoints userreference views views_fusion views_rss views_theme_wizard views_ui watchdog xstatistics What am I looking in a person for this job: - Good writing skills. - Friendly and funny attitude. - Of course experience with Drupal (better if you have already created a social networking site with it) Well, I guess thats it. Please do not post generic bids. Payment will be through GAC. Thank you all. ## Deliverables 1) Complete and fully-functional working program(s) in executable form as well as complete source code of all work done. 2) Deliverables must be in ready-to-run condition, as follows (depending on the nature of the deliverables): a) For web sites or other server-side deliverables intended to only ever exist in one place in the Buyer's en...
...the games into an existing site and MySQL/PHP database. This is a pretty straight forward project that should be easy to understand. I will give all of the details to serious bidders who can show examples of related work. Them we can discuss price. PAYMENT TERMS: Full payment will be made upon completion of the project and upon my final approval. Full payment will be made via PayPay/your GAC Account/or Western Union. These are the only payment terms do not ask to change them. NOTE: There will be much more related work for the successful developer. Once you have reviewed the outline for the project then we can discuss pricing. Just make a placement bid for now until you have seen the outline. NOTE: Do Not place outrageous bids they will be ignored. I am looking f...
...We are fastest growing software & web development company from India,& plan to recruit 300 plus developers & designers in every aspect & platfrom Ok now we are looking for business develoopers who can bring us business from their sources,WE will pay some unbelievable commisions for it. What you have to do is that bring newer business from ur own sources,i.e websites like Gaf,Gac etc or any of your sources,We will pay you the decided commission,& you dont have to worry that the project is completed or not ,You will get ur commision as soon as we get the project payment or the advance, You will also be provided all the technical backups,& we can also employ the attractive salary, if you promise to bring a average business every month Please P.M....
Hello, I need a clone of getafreelancer or getacoder or iFreelance or joomlnacers. You can suggest others ... What I need is a already done solution. Please send me your demo URL including admin access. I need the website to support PayPal and moneybooker. Please let me see your online demo Looking forward your bidding.
Promote and recruit members to Websites. Two sites with similar scripts but different themes for youth (like Friendster, MySpace, Friendfinder, hi5, YouTube. These sites are just given as easy reference only as our sites are quite different in their own right) with community & social networking and a host of unique and interesting features, including swap & auction, video, audi...including paid membership and give figures with a timeline. You should be highly result-orientated. Give your budget based on this timeline vis-à-vis the results you can achieve. Project includes some Website management so you need the usual skills and knowledge in PHP, MySQL, MS SQL, etc. If you are really good we can work on a longer term basis. Note: Similar project will be posted in GAC...
Required video sharing script to be integrated to a social networking site like PHPFox (already available). I already have several versions of the those available on the Internet like clip-share, attachmax, etc. so I need a superior version with the latest updates. The script should have advertising features such as those in revver or when the video clips are downloading, etc. It ...or as part of the account which will show thumbs to recommend what the user may like to view. Only those who have developed the video script need apply. Please provide your proposal for an enhanced video-sharing script with advertising features and perhaps something that can act like an online TV. Price is not important as I can pay for a good script. Note: Similar project will be posted in GAC, ...
I need exact clone of getafreelancer or getacoder or iFreelance Please send me your demo URL including admin access so that I could check on. Looking forward your bidding. *** Please dont bid if U dont have any demo already developed.
hi i need the images (PSD) to be sliced as web pages. Should use only div controls (css... check techcrunch dot com), strictly no tables. You can use the techcrunch dot com's css menu style. but the background image should be as per given image... There is an option to interchange the menus (left to right / middle, other combinations too) download lin...style. but the background image should be as per given image... There is an option to interchange the menus (left to right / middle, other combinations too) download link: I need demo of this one... dont worry i will not cheat you.. if we are happy with your work we many need this design to be converted for wordpress. payment through paypal/GAC The cost of the project is $30.
Description I want an exact clone of I will pay for a server and would expect you to install this script on the server with design (I will tell you the color scheme etc). Please show demo (for me to see your designing capabilities) and backend (for me to look at the admin functions of this script). Thanks.