Latest visual basic jobs coimbatorepekerjaan

Tapis

Carian terbaru saya
Tapis melalui:
Bajet
hingga
hingga
hingga
Jenis
Kemahiran
Bahasa
    Status Pekerjaan
    598,480 latest visual basic jobs coimbatore tugasan ditemui, harga dalam USD
    create joomla Tamat left

    ada tak sesiapa yang boleh create basic website Joomla? tapi saya minta bayaran harga student sebab saya masih student lagi

    $26 (Avg Bid)
    $26 Avg Bida
    2 bida
    Editor Tamat left

    Penganalisa gambar visual

    $350 (Avg Bid)
    $350 Avg Bida
    5 bida

    Saya ingin membuat company brochure saya. Basic content sudah ada. Cuma perlukan layout design dan juga cadangan content. Syarikat saya ialah HR dan consulting boutique consulting firm. Saya suka design yang clean tetapi ceria. Tidak banyak pager, cuma mungkin dalam maximum 5 pages, depan belakang.

    $129 (Avg Bid)
    $129 Avg Bida
    10 bida

    saya mahu buat sistem menggunakan Visual basic

    $42 (Avg Bid)
    $42 Avg Bida
    2 bida

    Pembutan program dari bahasa pemerogaman c# misalnya : prohram absensi, program kasir dll

    $22 - $180
    $22 - $180
    0 bida

    Apakah ada freelancer yang menguasai pengembangan aplikasi Visual Studio C++ untuk Windows CE - Windows Embedded? Saya mengoperasikan sebuah gudang di mana setiap bulannya saya melakukan proses stock opname secara manual (menghitung stock di lapangan dan mencocokannya di database MySQL). Saya ingin sedikit mengautomasi proses ini menggunakan perangkat mobile yang sudah dilengkapi dengan barcode...

    $625 (Avg Bid)
    $625 Avg Bida
    3 bida

    Menulis artikel - artikel mengenai segala hal tentang musik, mulai dari basic sampai intermediate yang biasanya hanya diberikan di tempat - tempat kursus profesional.

    $111 (Avg Bid)
    $111 Avg Bida
    1 bida

    Membuat 2 buah form yang digunakan untuk komunikasi visual (telekonfrence), interface dibuat dengan menggunakan foxpro.... bekerja pada jaringan lokal aplikasi server bebas

    $3255 (Avg Bid)
    $3255 Avg Bida
    1 bida

    Potreban Angular web dizajner iz Srbije. Prednost ako si iz Beograda. Treba da se radi sa [log masuk untuk melihat URL] Koliko mozes vremena da posvetis ovom projektu. Ostavi mail da mogu da te kontaktiram.

    $10 / hr (Avg Bid)
    $10 / hr Avg Bida
    4 bida

    Menurut Abd Rasid Ismail, (2012) motif menjadi unsur visual yang utama dalam karya seni dan ia juga merupakan imej yang dihasilkan bagi mengindahkan sesuatu hasil seni termasuk tekstil. Pereka tekstil dalam penghasilan sesuatu reka corak batik biasanya mendapat ilham daripada alam persekitarannya. Seni tekstil tanpa corak dan motif akan dilihat lesu ataupun hambar. Terdapat pelbagai motif yang bi...

    $25 - $206
    $25 - $206
    0 bida
    CmyLive.com VJ Tamat left

    Company On Connection Sdn.Bhd. ingin mewujudkan sebuah program terbaru CmyLive, iaitu sebuah online TV dan memerlukan VJ yg berpesonaliti dan mempunyai rupa paras yg menarik, petah berkata-kata serta mempunyai bakat tersendiri seperti menyanyi dll. Sebelum ini syarikat On Connection telah mewujudkan sebuah online TV MfaceLive/[log masuk untuk melihat URL] , tetapi hanya dalam versi bahasa Cina ...

    $8 - $25
    $8 - $25
    0 bida

    Membuat penggabungan 3D dengan latar belakang (video footage) Melakukan Storyboard Melakukan Narasi Melakukan Color Correction Melakukan Compositing 2D, Sound effect dan Visual effect Melakukan modeling 3D Melakukan penulisan naskah cerita Melakukan camera tracking

    $180 - $540
    $180 - $540
    0 bida

    Asslam o alikum jnb mujhe jobs chahye but mein yaha new hun mujhe nahi pta kia karna kise karna hai to help bhi kare aur kam bhi sekhaye han mein website bna dakta hun hun achi tarh

    $457 (Avg Bid)
    $457 Avg Bida
    1 bida

    Dicari freelancer untuk mengajar ASP.NET dengan spec berikut: Basic HTML + CSS Basic C# ASP.NET + [log masuk untuk melihat URL] T-SQL: CRUD Operation Tool: VS2012 atau VS2013 10x pertemuan @3jam/session Jam belajar pagi/siang - Lokasi Yogyakarta Start: 10 Nov 2014

    $118 (Avg Bid)
    $118 Avg Bida
    2 bida

    Saya akan mengerjakan semua pekerjaan online ini . dan menyelesakain semua jobs yang di berikan , dan bila melampaui deadline saya sanggup tidak di bayar . saya akan laku kan demi pekerjaan ini

    $10 (Avg Bid)
    $10 Avg Bida
    1 bida

    Programiranje visual basic

    $15 (Avg Bid)
    $15 Avg Bida
    1 bida

    hi semuanya, saya punya 2 job yg simple dengan bayaran yang tidak seberapa job ini di utamakan ke org yg saya invite, but tidak tertutup kemungkinan akan dilempar ke org lain apabila yg bersangkutan tidak bersedia, mengingat bayarannya tidak seberapa , so feel free to put a msg on PMB. job pertama budget $30 untuk memasukan data product kedalam web saya productnya berupa pakaian yg jumlahn...

    $166 (Avg Bid)
    $166 Avg Bida
    1 bida

    Membuat aplikasi dengan menggunakan aplikasi Visual Basic. Aplikasi yang akan saya buat untuk anda dapat digunakan untuk mempermudah pekerjaan anda yang berimbas kepada efisiensi waktu yang anda habiskan. Dengan aplikasi yang saya buat, anda hanya akan memasukkan data, dan aplikasi yang saya buat akan mengolah data secara otomatis.

    $115 (Avg Bid)
    $115 Avg Bida
    2 bida

    hi semuanya, saya punya 2 job yg simple dengan bayaran yang tidak seberapa job ini di utamakan ke org yg saya invite, but tidak tertutup kemungkinan akan dilempar ke org lain apabila yg bersangkutan tidak bersedia, mengingat bayarannya tidak seberapa , so feel free to put a msg on PMB. job pertama budget $30 untuk memasukan data product kedalam web saya productnya berupa pakaian yg jumlahnya men...

    $826 (Avg Bid)
    $826 Avg Bida
    4 bida

    hi semuanya, saya punya 2 job yg simple dengan bayaran yang tidak seberapa job ini di utamakan ke org yg saya invite, but tidak tertutup kemungkinan akan dilempar ke org lain apabila yg bersangkutan tidak bersedia, mengingat bayarannya tidak seberapa , so feel free to put a msg on PMB. job pertama budget $30 untuk memasukan data product kedalam web saya productnya berupa pakaian yg jumlahn...

    $12 / hr (Avg Bid)
    $12 / hr Avg Bida
    11 bida

    hi semuanya, saya punya 2 job yg simple dengan bayaran yang tidak seberapa job ini di utamakan ke org yg saya invite, but tidak tertutup kemungkinan akan dilempar ke org lain apabila yg bersangkutan tidak bersedia, mengingat bayarannya tidak seberapa , so feel free to put a msg on PMB. job pertama budget $30 untuk memasukan data product kedalam web saya productnya berupa pakaian yg jumlahnya men...

    $683 (Avg Bid)
    $683 Avg Bida
    1 bida

    Pendidikan dari jenjang SMK saya sudah mengenal dunia IT dengan mengambil jurusan Rekayasa Perangkat Lunak (RPL), dengan berbagai macam materi mulai dari software development hingga tes kompetensi dari tim penilai ITS Surabaya. Dilanjutkan dengan menempuh pendidikan di perguruan tinggi negeri di Surakarta mengambil jurusan D3 Teknik Informatika Universitas Sebelas Maret Surakarta.

    $6 / hr (Avg Bid)
    $6 / hr Avg Bida
    1 bida

    saya menguasai Bahasa pemograman website seperti HTML ,CSS , PHP , mySql , Javascript dan Pembuatan aplikasi menggunakan Visual Basic atau C++ Saya ingin menjadi seorang webmaster dan juga pembuat aplikasi yang sukses kelak . saya selalu berusaha keras untuk mewujudkannya

    $7 - $22
    $7 - $22
    0 bida

    saya menguasai Bahasa pemograman website seperti HTML ,CSS , PHP , mySql , Javascript dan Pembuatan aplikasi menggunakan Visual Basic atau C++ Saya ingin menjadi seorang webmaster dan juga pembuat aplikasi yang sukses kelak . saya selalu berusaha keras untuk mewujudkannya

    $36 - $1440
    $36 - $1440
    0 bida

    hi semuanya, saya punya 2 job yg simple dengan bayaran yang tidak seberapa job ini di utamakan ke org yg saya invite, but tidak tertutup kemungkinan akan dilempar ke org lain apabila yg bersangkutan tidak bersedia, mengingat bayarannya tidak seberapa , so feel free to put a msg on PMB. job pertama budget $30 untuk memasukan data product kedalam web saya productnya berupa pakaian yg jumlahnya men...

    $100 (Avg Bid)
    $100 Avg Bida
    1 bida

    hi semuanya, saya punya 2 job yg simple dengan bayaran yang tidak seberapa job ini di utamakan ke org yg saya invite, but tidak tertutup kemungkinan akan dilempar ke org lain apabila yg bersangkutan tidak bersedia, mengingat bayarannya tidak seberapa , so feel free to put a msg on PMB. job pertama budget $30 untuk memasukan data product kedalam web saya productnya berupa pakaian yg jumlahnya men...

    $50 / hr (Avg Bid)
    $50 / hr Avg Bida
    1 bida

    We are an event company that is looking for people to work for us full time and part time. We offer attractive daily/weekly/monthly salary based on which position you are looking for. We also offer contracts for people who are looking for long term part time jobs. Part Time Promoter We have event constantly every weekend so we need a lot of profile for part time promoters. Promoters usually do...

    $127 (Avg Bid)
    $127 Avg Bida
    1 bida

    Hi, I need data entry workers for a simple typing job. requirement : 1: basic internet knowledge. 2: well typing speed . 3: well internet connection. 4: payment method: perfectmoney/ moneybookers/webmoney/gaf/freelancer/oDesk payment time weekly on Monday . Lowest bid should be awarded . For new freelancer its very beauty full chance to have a great review . place a b...

    $204 (Avg Bid)
    $204 Avg Bida
    3 bida

    hi semuanya, saya punya 2 job yg simple dengan bayaran yang tidak seberapa job ini di utamakan ke org yg saya invite, but tidak tertutup kemungkinan akan dilempar ke org lain apabila yg bersangkutan tidak bersedia, mengingat bayarannya tidak seberapa , so feel free to put a msg on PMB. job pertama budget $30 untuk memasukan data product kedalam web saya productnya berupa pakaian yg jumlahnya men...

    $30 (Avg Bid)
    $30 Avg Bida
    1 bida

    hi semuanya, saya punya 2 job yg simple dengan bayaran yang tidak seberapa job ini di utamakan ke org yg saya invite, but tidak tertutup kemungkinan akan dilempar ke org lain apabila yg bersangkutan tidak bersedia, mengingat bayarannya tidak seberapa , so feel free to put a msg on PMB. job pertama budget $30 untuk memasukan data product kedalam web saya productnya berupa pakaian yg jumlahnya men...

    $30 (Avg Bid)
    $30 Avg Bida
    1 bida
    Visual Basic Tamat left

    Hallo, Saya mahasiswa semester 5 di perguruan tinggi di Palembang, saya disini menawarkan jasa saya, saya dapat menguasai visual basic walaupun itu msh tahap belajar. Jika anda bersedia untuk mempekerjakan saya, saya akan mejalani tugas saya dengan semaksimal mungkin, saya juga disini untuk mencari wawasan pengetahuan saya. terima kasih..

    $14 (Avg Bid)
    $14 Avg Bida
    1 bida

    hi semuanya, saya punya 2 job yg simple dengan bayaran yang tidak seberapa job ini di utamakan ke org yg saya invite, but tidak tertutup kemungkinan akan dilempar ke org lain apabila yg bersangkutan tidak bersedia, mengingat bayarannya tidak seberapa , so feel free to put a msg on PMB. job pertama budget $30 untuk memasukan data product kedalam web saya productnya berupa pakaian yg jumlahnya men...

    $30 (Avg Bid)
    $30 Avg Bida
    1 bida

    Saya ingin seorang penulis cerpen yg mampu menulis cerita bercabang. Lebih baik yg mengenal istilah visual novel atau otome dan anime. Project kecil ini untuk membuat game kecil yang berbasis 'bentuk nasib anda' dengan memilih pilihan2 yg muncul di dalam game. Genre: mystery, romance, mungkin horor. Yang dituju: pemain wanita. Sudut pandang pertama. Bentuk naskah. Saya ingin penulis yan...

    $65 - $86
    $65 - $86
    0 bida

    hi semuanya, saya punya 2 job yg simple dengan bayaran yang tidak seberapa job ini di utamakan ke org yg saya invite, but tidak tertutup kemungkinan akan dilempar ke org lain apabila yg bersangkutan tidak bersedia, mengingat bayarannya tidak seberapa , so feel free to put a msg on PMB. job pertama budget $30 untuk memasukan data product kedalam web saya productnya berupa pakaian yg jumlahnya men...

    $30 (Avg Bid)
    $30 Avg Bida
    1 bida

    Samsung Galaxy s4 superking V4 latest model with 8.86gb internal phone storage ram2gb 15.90gb brighter camera flash the same as ori!! AMOLED HD screen!! and hp is more spread out and hold events dimana2 place! SPED 4g internet! visit my fanpage - >> [log masuk untuk melihat URL] if u cans sale my items in 2 day. i will pay you bugget my ass! FREE SCREEN PROTECTOR DIAMOND, FREE FLIP ...

    $25 - $206
    $25 - $206
    0 bida

    hi semuanya, saya punya 2 job yg simple dengan bayaran yang tidak seberapa job ini di utamakan ke org yg saya invite, but tidak tertutup kemungkinan akan dilempar ke org lain apabila yg bersangkutan tidak bersedia, mengingat bayarannya tidak seberapa , so feel free to put a msg on PMB. job pertama budget $30 untuk memasukan data product kedalam web saya productnya berupa pakaian yg jumlahnya men...

    $30 (Avg Bid)
    $30 Avg Bida
    1 bida

    we are in need of "overflow" project management help Task and jobs will range from assisting in formulating proposals to helping coordinate projects and providing direction, making sure tasks and projects are on track and managing developers suppliers and helping set up / onboard new suppliers We are looking for people with project management and those who are familiar and have exper...

    $22 / hr (Avg Bid)
    $22 / hr Avg Bida
    9 bida

    I have a plain 3DS Max model of a blimp. I need some basic materials, lighting and texturing, along with basic rigging and animation of the propellers & running lights. This is not a difficult project; I just don't have time to get up to speed on 3DS Max and am looking for some quick outside help. Thanks for bidding!

    $167 (Avg Bid)
    $167 Avg Bida
    4 bida
    google sites Embeded Quiz 6 hari left
    DISAHKAN

    Need code for google sites to conduct quiz with timer. code should collect basic info of students.

    $10 (Avg Bid)
    $10 Avg Bida
    1 bida

    Our app is already live. would like to upgrade with the new design. want to have latest UI/UX. If you are interested let us know to discuss further and receive your bids

    $10 (Avg Bid)
    $10 Avg Bida
    1 bida

    our app is already live. would like to upgrade with the new design. want to have latest UI/UX. If interested let us know to discuss further and receive you bid

    $10 (Avg Bid)
    $10 Avg Bida
    1 bida

    Bodinoz makinesinden çıkan silindir haldeki poşeti, naylon önlüğe çevirmek istiyoruz. Kendimizce tasarladığımız ve çizdiğimiz görsel ve yapmak istediğimiz ürünün ölçüleri ve son hali ektedir. Çizdiğimiz makinenin birebir aynısı olması şart değil, önemli olan istediğimizi ürünü alabilmektir. İlk etapta ta...

    $1500 (Avg Bid)
    $1500 Avg Bida
    2 bida

    Hi, want a react application that contains two pages. 1. Both pages must have a table with Five columns-: Names of column Sr no, Drug Name, Generic Name, Brand Name. 2. On the first page, I should be able to delete, add and edit any of the columns of the table and changes I make in the table of the first page must be visible in the second-page table( Means all changes must be updated on second-p...

    $20 - $167
    Sulit
    $20 - $167
    6 bida

    I want someone to set up a simple test Visual Studio Wep API project and deploy it to HostBuddy via the publish FTP. I've attached the files that I was using that only has one controller as a test sample. I will give you total admin right the the HostBuddy account I just set up, along with the domain name. What I want once completed is that I can do a url query to the one control and get a...

    $26 (Avg Bid)
    $26 Avg Bida
    4 bida

    We are working on a video room concept that is stable in its basic build however we are facing below mentioned - Issues with Idea network - Issues with stability and connectivity - Help with scale-up Its not more than 3 hours job for an expert but we are setting the timeline for a week. We are looking for someone who has good hands-on with Janus VideoRoom bridges. Our implementation is already...

    $125 (Avg Bid)
    $125 Avg Bida
    1 bida

    if you can join or connect these words in a way so that they make sense then i have jobs for you and you are not suppose to skip any word you can move that word but cannot delete or alter or change in any way here are the words. One COMPLETE word is in BETWEEN ( - ) dash symbol if you want to move then move the whole word not part of it for example ( electrician periodic inspection explained ) tha...

    $18 (Avg Bid)
    $18 Avg Bida
    6 bida

    I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG

    $10 / hr (Avg Bid)
    $10 / hr Avg Bida
    1 bida
    I need a web developer 6 hari left
    DISAHKAN

    I want to create an anime streaming website where it embeds the latest videos automatically with my own video player rather than scraping off other websites. I want similar site like: [log masuk untuk melihat URL]

    $472 (Avg Bid)
    $472 Avg Bida
    24 bida
    Editing videos 6 hari left
    DISAHKAN

    I am a hobby producer of porn films. I have around 15 films at the moment which I shot before the pandemic and which mostly have not been published yet. I am thinking about publishing those on a few websites like Pornhub, xhamster and others. To achieve this they need some basic editing. And for this I might need some advice. Is anyone interested in providing me that advice? It would basically com...

    $17 / hr (Avg Bid)
    $17 / hr Avg Bida
    19 bida

    Startup healthcare company in the telecare space seeking Outsystems certified developer to assist with the engineering of a health care application for caregiver communication. Capabilities: Developer should be able to have some coding knowledge specifically regarding basic front end technologies HTML/CSS, JS, Python with Mongo or Django a plus Responsibilities: + Working with our UX lead to...

    $23 / hr (Avg Bid)
    $23 / hr Avg Bida
    11 bida