Ppt template dnapekerjaan

Tapis

Carian terbaru saya
Tapis melalui:
Bajet
hingga
hingga
hingga
Jenis
Kemahiran
Bahasa
    Status Pekerjaan
    178,319 ppt template dna tugasan ditemui, harga dalam USD

    template sesuai kengingan anda

    $413 (Avg Bid)
    $413 Avg Bida
    4 bida

    melalui excel word dan ppt,, entry data menjadi lebih mudah

    $159 (Avg Bid)
    $159 Avg Bida
    2 bida

    Rental Services [log masuk untuk melihat URL] Ye ek server company hi jo Bhopal main serve karaoke website main data dalana hain

    $379 (Avg Bid)
    $379 Avg Bida
    1 bida

    Mengubah template alterna wordpress untuk website event silahkan kunjungi [log masuk untuk melihat URL] dan lihat bagian footer sebelah kanan untuk berdiskusi lebih lanjut melalui (Removed by Freelancer.com admin for breaching Terms and Conditions)

    $50 (Avg Bid)
    $50 Avg Bida
    4 bida

    Proyek saya adalah : ini tentang saya. dimana, saya ingin memperbagus template blog saya, memperbanyak follower di Google+, membuat youtube yang berkaitan dengan blog travelling saya, meningkatkan jumlah follower di Fanpage saya, mengurus twitter, pinterest.

    $46 (Avg Bid)
    $46 Avg Bida
    2 bida

    fix [log masuk untuk melihat URL]

    CSS
    $110 (Avg Bid)
    $110 Avg Bida
    1 bida

    Redesign template Wordpress [log masuk untuk melihat URL] Silahkan lihat konsep template yang sisipkan ASSIGNMENTS DUE : now - 17/08/2014

    $68 (Avg Bid)
    $68 Avg Bida
    10 bida

    have a digital marketing project update PPT to be jazzed up in terms of design

    $14 (Avg Bid)
    $14 Avg Bida
    1 bida

    need someone who can convert PPT video into word document

    $325 (Avg Bid)
    $325 Avg Bida
    52 bida

    Cerco una figura , sia maschile che femminile che sappia creare ed editare video con Canva. Si richiede conoscenza della lingua italiana e l'utilizzo del software Canva. E' un lavoro semplice ma continuativo nel tempo. Se sei un graphic designer , un video editor , o uno scrittore seo contattami.

    $14 / hr (Avg Bid)
    $14 / hr Avg Bida
    5 bida

    Looking to have a data feed for our affiliate program made asap! will tip thank you!

    $23 (Avg Bid)
    $23 Avg Bida
    5 bida

    Research paper with the PPT presentation on "machine learning applications in e-commerce" includes the following: 1-Abstract 2- Introduction and Background 3- Technology description 4- Applications and Importance 5- Research Challenges 6- Conclusion 7- References Notes: * Reliable resources * 15 references * 15 pages

    $97 (Avg Bid)
    $97 Avg Bida
    30 bida
    EDIT HTML WEBSITE TEMPLATE 6 hari left
    DISAHKAN

    Hello, I have a template that needs to be edited can you handle this? Logo Colour change Icons redesign Changes to be made to be suitable for my use

    $99 (Avg Bid)
    $99 Avg Bida
    43 bida

    We are creating a website for watches spare parts shops. The goal of this website is to let people search these kind of shops from all over the World. In order to create it, we are using a Themeforest Template for Wordpress which we think could be the one. Basically it is a WORDPRESS LISTINGS WEBSITE with geolocalization features. We are searching for any developer who can solve some major bug...

    $19 / hr (Avg Bid)
    $19 / hr Avg Bida
    14 bida

    Online jewelry shop, with external appearance like ASTRA templet. Must have: coupons that enables it`s distributer a commission. Samples that can copied will be appreciated.

    $196 (Avg Bid)
    $196 Avg Bida
    22 bida

    I need to create from .XD file to template using parallax effects.

    $33 (Avg Bid)
    $33 Avg Bida
    27 bida

    Need help in converting SAM template into cloud-formation template

    $8 - $20
    $8 - $20
    0 bida

    I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG

    $6 / hr (Avg Bid)
    $6 / hr Avg Bida
    3 bida

    Need help to convert sam templates into CF templates

    $8 - $20
    $8 - $20
    0 bida

    I have 2 Project have allready the Wordpress Template and need images and content change on it. The Template has about 30 Pages no hard work

    $174 (Avg Bid)
    $174 Avg Bida
    31 bida
    presentation and speak note 6 hari left
    DISAHKAN

    There is an article that needs to be read carefully and designed as PowerPoint slides and note speak, there is a highlight point that is the main point and some examples to present, and this assessment will be a tutorial leader. I am going to lead the class and present to them about politics and protected areas. at the end of PPT will be some questions for discussions. There are instructions as w...

    $86 (Avg Bid)
    $86 Avg Bida
    22 bida

    need to transfer psd template to wp

    $164 (Avg Bid)
    $164 Avg Bida
    86 bida

    I have an email that needs to be created in HTML and needs to appear properly in Outlook, GMail, iOS email, and Android Email. I will provide the text and a draft layout. I will accept suggestions for how to modify the layout for best viewing on all platforms. The deliverable is the HTML that will properly render on the important platforms. I am looking for someone who does HTML email templates...

    $113 (Avg Bid)
    $113 Avg Bida
    22 bida

    We are looking for a ppt designer who makes infographics from our technical and healthy documents. We need make 26 infographics by month.

    $99 (Avg Bid)
    $99 Avg Bida
    37 bida

    Please note, if you do not read the description and you fail to complete the work to a good level, Freelancer will be reported. I need a new employer to be added to the CV, the CV and the new logo are attached. Location: Kent Community NHS Position - Mass Vaccine Centre Manager Pay: Band 8A Responsibilities: Responsible for the operational management and oversight of the mass vaccination site. ...

    $13 (Avg Bid)
    $13
    11 penyertaan

    Attached a preview how it should look like. But here it's necessary to bend the graphic on armes and legs. This is exactly your part! Please bend on legs and armes the circulatory system on arms and legs. And create the side view of the armes with the circulatory system (eps attached) Thanks

    $25 (Avg Bid)
    $25 Avg Bida
    10 bida

    hi! we had a Wordpress template made its already live but the site is 'too wide'. sidebar is not fitting and is now in footer site etc so we need someone to fix this today to make homepage/page/post less wide

    $17 / hr (Avg Bid)
    $17 / hr Avg Bida
    52 bida

    more details will be after connecting

    $65 (Avg Bid)
    $65 Avg Bida
    13 bida

    Particulars: 1) Templates to choose from 2) Web Pages to be designed 3) Custom images to be added 4) Integrate existing social accounts 5) SEO Ready - No logos to be created - Text and images will be provided - Separate sub-pages for gallery and block section to be added - Access will be provided via anydesk

    $22 (Avg Bid)
    $22 Avg Bida
    6 bida

    Hello I need a small website will all elements using HTML, CSS and a report + PPT based on the same. Compensation: INR 2500 Deadline: 1 day No teams or companies please.

    $59 (Avg Bid)
    $59 Avg Bida
    35 bida

    Hello I bought this after effects template and I need someone to update the logo and update the phone and images with my app images. I have an app and I need I want use this after effects to show off its features. Im trying to learn after effects so I need someone to make these changes but also record there screen. This is the template I bought that you will be updating. [log masuk untuk melihat...

    $26 (Avg Bid)
    $26 Avg Bida
    19 bida

    Hi, I need a freelancer that can adapt this cover into 50 new ones with different picture and title. The freelancer must search for the images on the web. Each version has a spanish and english version. All fonts and templetes will be given. Basically its only adding the image and changing the title header. Easy work.

    $26 (Avg Bid)
    $26 Avg Bida
    28 bida

    Hello, there i here want build template for my movies wordpress professional 2021 , with slides and prising slides And contact slide with login and sign up And saperat with movies . This biggest movie website like a netflix

    $211110 (Avg Bid)
    $211110 Avg Bida
    2 bida

    Hello, there i here want build template for my movies wordpress professional 2021 , with slides and prising slides And contact slide with login and sign up And saperat with movies . This biggest movie website like a netflix

    $320 (Avg Bid)
    $320 Avg Bida
    24 bida

    Owner of College Prep Genius. I have 12 speeches I want designed using powerpoint. I want them to look professional, be diversified with charts, graphs...I need them asap. My conference is Tuesday-Monday of next week. The ppt slides are approx. 60ish in number. The person doing the project will need to sign an NDA. I would like samples, reviews and cost as well as turn around time.

    $118 (Avg Bid)
    Perjanjian Kerahsiaan
    $118 Avg Bida
    20 bida

    I need a quote designed using word for team leader [log masuk untuk melihat URL]

    $27 (Avg Bid)
    $27 Avg Bida
    7 bida

    Hello, I need to convert a PDF file of 230 pages to a PPT file. Each new Lesson should start in a new slide. The book is written in romanian.

    $143 (Avg Bid)
    $143 Avg Bida
    30 bida

    Install a template on a prestashop web site. Make categories easier to navigate. Set up navigation menu. Update prestashop to the latest version.

    $442 (Avg Bid)
    $442 Avg Bida
    43 bida

    We are creating a collection of digital collectible cards for the best poker players in the world. These cards will be like baseball cards, but they will only exist digitally. We need someone to design a set of templates which can be overlayed on top of photos of the poker players to give the collector a very valuable, high quality, and consistent feel for all the poker players' cards in a ...

    $300 (Avg Bid)
    $300
    12 penyertaan
    Email Template Designer 5 hari left
    DISAHKAN

    I am looking for someone who can design HTML templates for an email campaigns.

    $23 (Avg Bid)
    $23 Avg Bida
    10 bida

    I have a template in laravel, I would like to setup CI CD and also push docker image to azure app service via Azure Devops

    $37 (Avg Bid)
    $37 Avg Bida
    4 bida

    Hi there. We are looking for someone who can build a Conga Composer template solution for Salesforce. This template would automatically be populated by our Salesforce users on the click of a button. We have the Salesforce logic ready, and are looking for someone with proven experience in Conga solutions to build this template based on the logic, and informally train 1 or 2 of our users on the pro...

    $32 / hr (Avg Bid)
    $32 / hr Avg Bida
    11 bida

    Hello I am looking for custom work done on a shopify template, we are looking for text to be placed under a product image and to be on every image on our site and any new prodcuts that will be added in future. Attached image of our site urban vape and we have also attached an image of the text we need added.

    $29 (Avg Bid)
    $29 Avg Bida
    16 bida
    Summary WTO 5 hari left
    DISAHKAN

    1.5 page long summary from a 7 pages pdf file. In addition 2 slides of PPT from that summary

    $26 (Avg Bid)
    $26 Avg Bida
    42 bida

    OUR COMPANY MANUFACTURE PAPER PACKAGING PRODUCTS WE ARE LOOKING FOR A CONTENT WRITER HELP US MAKING OUR PPT.

    $22 (Avg Bid)
    $22 Avg Bida
    24 bida

    Hello, I have a ppt for a startup pitch deck that i need to design it to show to investors. Please send samples of your previous work.

    $31 (Avg Bid)
    $31 Avg Bida
    16 bida

    We are in to bike/ scooter rental business needed good business presentation for conference . Need good ppt designer and good content writer for the same . Preferable from india

    $48 (Avg Bid)
    $48 Avg Bida
    5 bida

    Create Website with a template on to wordpress or joomla

    $55 (Avg Bid)
    $55 Avg Bida
    37 bida