Seed key algorithm analysis disassemblypekerjaan
project ini merupakan fyp saya. saya perlu mencari error dalam sliding mode contoller dan PID controller dalam pre-sliding motion. sya perlukan sesorang yang boleh buat PID dan SMC simulink dan saya hanya perlu masukan nila transfer function nilai x untuk cari error. nilai transfer function sudah diberi.
robot control, MATLAB simulink
Real Estate CRM Part 1 - multiple users (Staff 1, Staff 2, Closer 1, Closer 2 and etc) - Manually key in leads generated by staff (user) {Leads will contain multiple screenshots upload} - Submit the leads Part 2 - Closer 1 can login - Will have column like pending, completed, follow up - The pending column item will be reviewed and update the status and action accordingly. If require fur...
I have some work, in an Excel spreadsheet. Saya mempunyai [log masuk untuk melihat URL] dalam tugasan keyin data. Selama 12 thn pengalaman saya 1. 2 tahun bertugas di rangkain segar sebagai key in data kad touch n go 2. 10thn bertugas di maktab tentera menyaip buku, jurnal pegawai tentera.
I have some work, in an Excel spreadsheet. Saya mempunyai [log masuk untuk melihat URL] dalam tugasan keyin data. Selama 12 thn pengalaman saya 1. 2 tahun bertugas di rangkain segar sebagai key in data kad touch n go 2. 10thn bertugas di maktab tentera menyaip buku, jurnal pegawai tentera.
Analisa tulisan tangan untuk keperluan rekrutmen
Tujuan saya ingin membuat script adalah agar menjadi lebih hemat waktu dan efektif, dengan menggunakan hot key/shortcut button, konsep script sudah saya attach.
ini belum menjadi project, tapi kemungkinan besar akan menjadi projek,saya memerlukan konsultan lepasan yang bersedia membantu penyusunan KPI dan penyusunan Balanced Scorecard,dimana syarat minimalnya adalah pernah menjadi Manager di Divisi HRD/Strategic Plan atau apapun yang dimana sehari harinya bergelut dengan KPI,Balanced Scorecard dan Performance Management Terimakasih TA
speed data entry, data processing and audit report, financial report and taxation Melakukan data entry laporan harian dan bulanan, cash and bank report, export and import, inventory control report, data analysis and as a translator english to indonesia,
GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM
Milestone1: Upto 2-3 Pages It should contain the following. 1. Project charter 2. Problem statement – Existing problem or Goal statement – New / Idea 3. Business case Why is this project worth doing now? What are the consequences of not doing this project? Declare processes on the basis of priority (high , medium & low). It shoul...
Sila Dafter atau Log masuk untuk melihat butiran.
Hi, I’m looking for an expert in statistics and especially operations research, he or she need to be available immediately to help solve problems in operations research related to the following topics and concepts: - Linear programming - Sensitivity analysis - Graphical method - Simplex method - Shadow price - Dual problems - Binding & non-binding constraints Must be expert in the menti...
We are selecting "creative Dolphins" to join our team and help promoting CORKBRICK in Europe. People that share our vision ([log masuk untuk melihat URL]) and have the will, the talent and the network to help turning our dream into reality. Mission: To select and nurture flagship customers in major cities in Europe. Location: Remote, from major European cities. Target markets that ...
We are a newly launched startup, based out of Bangalore in India. We are creating a premium silver jewelry D2C brand and our website has just been launched. Seeking a digital marketeer with experience in jewelry e-commerce or at the least in the lifestyle space to help us with our digital marketing. We are looking for support in paid marketing through social media marketing and Google SEM. This ...
It’s a civil engineering work, and require a SAP expert ,with extensive training in structures and concrete and long experience in structural analysis. Require some structural , model, drawings and comprobations.
In a paragraph: -------------- There are a lot of software robots trying to access the servers in the Internet without permission. It is neccesary to make an application running continuously in the server to be a guard of what is happening related to attacks, work-load and unauthorized access to the server. Server characteristics: --------- Hardware: CPU: Intel(R) Xeon(R) CPU E3-1270 v6 @ 3.80GHz...
Statistical analysis is needed to be done for a secondary database, which needs descriptive statistical analysis to see the relationship between dependent and independent variables, also Chi-square tests and Logistic regression analysis. For a cross-sectional study in malnutrition.
I want someone expert in finance to do a financial analysis of 4 companies , the data will be provided to you , all you have to do is analyze the data and present the findings , this is small task of max budget $10
I need a web app developed using Flutter 2. The web app is going to be based on two popular anonymous chatting sites with some small additions - 1) [log masuk untuk melihat URL] 2) [log masuk untuk melihat URL] The main difference between this web app from the two mentioned above is that for this web app, registration and login are a must. Also, the text-only chats found in Omgle wouldn...
Our packaging ultimate guide We want the packaging to be both modern and on trend, but also timeless and universally appealing, so we want the packaging design looks up to date for as long as possible. we want to go for something less feminine but still want something elegant and detailed, a more clean and cool style may be right for us. We want Unique fonts that can give our packaging a whole l...
Will provide you the MT data and you have to predict the variables using PSO algorithm
What is required? - Writing bibliometric article (similar to the model paper) with the same structure - Key words: o Digitization; Internationalization; Science Mapping; Bibliometric Analysis; Content Analysis; International Business - Introduction Research Question: What are the research perspectives dealing with digitization and internationalization? In order to answer the research question: ...
The Master’s thesis is “Social Media and Society” and its title is: The impact of digital opinion leadership on political interest and participation in post-dictatorship Tunisia. I will provide the part of the thesis which is made up of the introduction and the literature review for better understanding of the research questions and the scope of the explored possible results. I w...
This is a case whereby my son and his ex wife were married when he was 23 and she was 21 and 2 days after the marriage she gave birth to my grandson in 2011. After 2 years when she got her green card, she took my grandson and left in July 2013. No communication till July 2016. From 7/2016 to 12/12/2018 ( divorce filed) , they do not live together . Each maintain separate household. Neither has key...
Its a simple DevSecOps Pipeline implementation, required wo are good at bash scripting aws, python , devops, Answer these below 1) In the Python file, write a program to access the contents of the AWS S3 bucket Alpha. In there there might be multiple files, but your program should find the file with the prefix _beta_, and then output the contents of that file. You should use the boto3 module to...
Hi, At this moment we have a system developed in Java with spring, hibernate and jpa with a database in MySQL, which allows us to add, modify products with simple data such as code, barcode, purchase price,% of profit, per family o type of product and supplier and a simple inventory. Customers and suppliers with simple data such as address and personal data, accounts receivable with receipts, use...
I am producing a self-made board game called Starsquares. The board for this game will consist of 20 black and white squares (as shown in the attached file), and the game's key mechanic is that at any point half of those squares are "protected". There needs to be some visual way to show which squares are protected, and some way to flip from one protected colour to the other. My plan...
I need a BA to research all the AI Categories and Sub Categories for a Artificial Intelligence website. Also help with website copy.
I have an assignment in VLSI design automation. It's about implementing Kernighan-Lin (KL) algorithm by using C++ in Visual Studio. I have the code already. All what we need to do is adding some extra lines of code to make the project complete. Also, I have notes about these lines of code. Can anyone help me to do this assignment? Thank you so much.
Dc-Dc converters are massively used for switch mode regulated power supply, renewable energy conversion system and electrical drives. In this paper we have implemented digital PID controller voltage mode control method on the dc-dc buck converter. Digital controller application is considered due to their superiority than the analog converter and due to more reliability. These converters are nonlin...
Adding an appartment by the registered iser wotks fine from PC and android. But it doesnt work fine from MAC or iPhone. So, the problem is with ios. I need help for this bug fix. To reconstruct the problem, register as a user, and compare adding an appartment from PC and ios. Then make your offer. This shouldnt be more then few lines of code, abd should be an easy job for somebody who already mea...
Use the data to conduct profitability comparative analysis Use software modeling to do linear regression analysis. Need methodology and result discussion
I have one medical use case which requires a mobile app and a neural engine that will consume the 2D image and convert it into a 3D model So basically, we need an app that can take pictures from all angles then convert them into the 3D model using an algorithm.
I would like to build a deep learning model using NLP that is able to recognize hidden costs in a 10-K or 10-Q financial statement, and extract the monetary value. There are about 7 different expense categories, each category has different keywords. Here are some examples: --- "Exploratory dry-hole costs were $12.7 million, $1.3 million, and $1.0 million for the years ended December 31, 2...
create decision tree ID3 algorithm and run it on three different datasets. the deadline is 12/04/2021
Looking for an Analyst to analyse a dataset and answer two questions, one in SQL and the other in Python and provide results in a precise and clear presentation. This is a one time project and would need a smart analyst to handle the project.
I have code for the genetic algorithm to choose the best meal based calories and vegetarian or not ( the code, not print fitness function and graphic )
Logistic regression report, including: - Introduction - Exploratory analysis - From initial to final model - Results - Comments about the data/analysis - Interpretation and conclusions for a lay audience
The job is to implement a memory management library. Library need to implement necessary initialization, allocation, deallocation. Library need to keep track of allocated and free spaces in the memory segment. Buddy memory allocation algorithm will be used. There will be functions for the library. There will be report which includes results etc. about code after writing the code. The functions and...
GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM
GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM
Hi everyone, I need your help to create static analysis in Ansys Workbench. The motorcycle design was already meshed. The tasks will be, For the first time you can try to take displacements on the front wheel for x, y, z. and on the rear wheel y, and z. also set to zero displacements all revolute and translation joints . you will add gravity. And run the simulation
I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG
Hello, i'm looking to make a parental app that include the following features. Let me know if it's possible. - Real Time Screen Monitor - Real Time Audio (background voice) - Real Time Location - Record Call - Access user pictures or videos - Key Logger
I have a data analysis task. I needed someone who can help me with this
