java project - need a fully experienced java freelancer
£20-250 GBP
Dibatalkan
Disiarkan lebih dari 4 tahun yang lalu
£20-250 GBP
Dibayar semasa penghantaran
need a java freelancer, who is an expert with java to solve three challenges, they are basic java coding challenges need to be done asap by a professional freelancer, should be done asap within 10-15 mins
here is challenges:
first:
* Within this Calculator class you will need to create 4 methods.
* The four methods will relate to the basic functions of a calculator and should be named:
* <p>
* - add
* - subtract
* - multiply
* - divide
* <p>
* Each method accept 'int' two numbers and return the int value.
* <p>
* Don't forget to look at the tests for guidance.
second:
* A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
*
* An example of a length 21 DNA string (whose alphabet contains the symbols 'A', 'C', 'G', and 'T') is "ATGCTTCAGAAAGGTCTTACG."
*
* Given: A DNA string s of length at most 1000 nt.
*
* Return: Four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in s.
*
* Sample Dataset
* AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
*
* Sample Output
* 20 12 17 21
*
*/
/**
* The Challenge
*
* You will need to implement the counters as per the name in names in the return statement.
* You will then need to create a loop to parse each Char within the string and count them
* by passing the values to counters.
third
HI I am software engineer and have done many java and technical projects. You can discuss more details with me so that we can negotiate the price accordingly. Thank you
Hello! :) I checked the description of your project and can tell that these tasks are very simple and I can complete them right now. I work as a Java developer full-time, so trust me, this "project" will be done in no time. Contact me for more details. Oh, btw, third solution description is missing.
Hello
I am having 10+ years of experience in development in same field.
https://www.freelancer.in/u/Mexi2705/ you can go with my profile.
I am full time freelancer.
Let's connect and discuss in details.
Thank you
HI,
lets have a chat about the specifications of the task. 1. will not work without clarification - the division might produce something else than an int.
About 3. we also should talk before starting this job.
Cheers,
Patrick
Hi, I have 10 years of rich experience in nava & I am working as a freelancer. I can assist you that I will not charge reasonably good with better quality output.