java project - need a fully experienced java freelancer

need a java freelancer, who is an expert with java to solve three challenges, they are basic java coding challenges need to be done asap by a professional freelancer, should be done asap within 10-15 mins here is challenges: first: * Within this Calculator class you will need to create 4 methods. * The four methods will relate to the basic functions of a calculator and should be named: * <p> * - add * - subtract * - multiply * - divide * <p> * Each method accept 'int' two numbers and return the int value. * <p> * Don't forget to look at the tests for guidance. second: * A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains. * * An example of a length 21 DNA string (whose alphabet contains the symbols 'A', 'C', 'G', and 'T') is "ATGCTTCAGAAAGGTCTTACG." * * Given: A DNA string s of length at most 1000 nt. * * Return: Four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in s. * * Sample Dataset * AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC * * Sample Output * 20 12 17 21 * */ /** * The Challenge * * You will need to implement the counters as per the name in names in the return statement. * You will then need to create a loop to parse each Char within the string and count them * by passing the values to counters. third